EST 1200604 is a singleton


Sequence

>1200604 (1 EST) Length=663 TTGTTATTTATATCATTATTTTTATTATCATGTCTATTATCCTTACCTTCACTATTACAATTACTATTATTATTATTTGT AGTAATATTATCCTCTTTTTGACCATTATCAATTTTGGTGTCATCCTTTTGTATATTAATATGACATTCATCATTATTAT TATTATTATTATCATTATTGTTGTTGTTGTCGTTGTTATTATTATTATTGATATTCTTCCTTGTGGAGCATTTTACGTCC GTTAATAAATTCAAGTGTACCTTTCCTTTGTTAGTTTTGATTAACGTGTCGCTTAACATTTTTGAAGAATTATTAACTTG ACAAGAAAATTTAAGAATATGATTATTAGCGTGAGGTGCCACATCTCCTGGTCGTTTTTCTTCCATATTAGTATAAACCA TATCATGATTAATATTAATATTATTATTATTATTATTATTTGCGAAATATGTAGGTGTGTCGTTAAAATTATTATATACA ACATTAACAGGGATGTTGTCGGGCATATATCCATATGAATATACATCTACATTTTGATTAGGCATACACTTATTCATATT AGATACCTTATCATTACACATAATATGGTTTGTATCATATATTACAGTATTATTCATATAATGAGAATTACATACTGAAT TAGGATGTGTATAAGTAGTAGTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1200604: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006042320846AA5505941759m3gmbPfHB3.1, G. Roman Reddy


Date: 6:3:24 on Sun 19 Nov 117.