EST 1200610 is a singleton


Sequence

>1200610 (1 EST) Length=767 TATATATTTTTTTTTTTATCCATTTTTATCATTCAAATGGGTCTTTATATTTTTTGTTCGTCTTATAAAATTTCTTGTCT GATGAATCATTGGAATTATCATGCTGGGATTCCGTTTCATTATTTTCATTATTCTTCTTATCAGCATTTTCTTTTCTTTT TTTTAAGAGATATCTTCTGTCTTGTTCAAAAATATCATACTTATCATTTGATGAACTACACCATGTTTCCATTTCAGTAT TTTTTGAATGAGATCTAGATTTATTCTTTTTATTATTATTATTATTATTCTTTTTATTAATATTTTTATTTTTATCAGGT GAAGGGAAAATGAAATGATCATCTTTACTTTTATTATATATTTTATAATTCTTTTCAACATATATATTATCTTTATCACA TTTTATCATTTTATCTTTTGTTTTATGATTACTCCTTTTTTTTTCACTCATTTTATTCTTTTCATTATTTATTATATATT TTTCGATTTCTTCTTTATATTTTTTATCCTTTCCTTTTTTTTTCTTTCTTTTAACTTTTATTTTTTTTTCTATTATAAGA TATTCTTCCATATCTGATTTATCATCAACTTTTTTTTTTATTGTAATTCGTTTTTTATTACCTAAGATACTATATAATTC ATCAACATAACCAACAGTGTTACTTTGAATTAAATAACAATCATCATCGACAGAAGAACAGGATAATTTATCATCTTCTT TTCTTTTCATATCATCACATTTTCCTTTTTTCTTAACATATATATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200610: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006102320852AA5506001767m3gmbPfHB3.1, G. Roman Reddy


Date: 11:54:54 on Wed 22 Nov 117.