EST 1200617 is a singleton


Sequence

>1200617 (1 EST) Length=602 CATTTACAAAATAAAATAATACATGTATAACTTTCTTTTTTTTTGGAATATGACTTGTTCAAACTATTTTATCAAGTGTA AAACGTCCGTGTTTTTATAACTGTTTGATTTTGATTCATTTATAAAGGAATATAAAATTTTTTTCCCTAACTCTTTTATG TATAAATTCATAAAATTTTGATATATTTTATTTTTCAACTAAGCAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAAAGT GAATACTTTATGAATAATGTAAACTTATTAAAATTTTGAGAAATTCACAGATACATAAAATATAGTATATTTACACACAC ACATATATACATATATAATATATATACAACATTTTTGTTACCCTAAAATTTATATAAAAATCAATGTTTATGCAATTCTT TTTTTCTTTAATTATCCACTCGGTTATCTATAAAAAGAACAATATATATATATATATATATTATAATGGACACACGATAT GTGCCTTATTTAAAATATATATAAGTATATATATTAATTTTTCTGTTTATATTTTTAATTAGTTGTCCCTTTATTATTAT TACATACCAAGTGATGAAAAATATTTGTATCTTCGCTAGATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200617: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006172320859AA5506071776m3gmbPfHB3.1, G. Roman Reddy


Date: 6:23:48 on Thu 23 Nov 117.