EST 1200618 is a singleton


Sequence

>1200618 (1 EST) Length=236 TTATTTTTTGTAAAGTGAAAATATGAAGGACATAAAACAGGCAGACGTAAAACATTATCTAGAAACTTATTACACAGATA ACAGTATAGGTGATGATTTGAAAGAGGCCTTTGATTATATNGAAAGAAATAAACATAAGAACAATTTCCATAAATTATTT GAAGATTANTTAGAAGATTATAATAAGAAGTTATTAAAAAATGGAACCTTGTTAAGAGATCATGTCGTTTATGAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200618: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006182320860AA5506081777m3gmbPfHB3.1, G. Roman Reddy


Date: 4:19:44 on Fri 24 Nov 117.