EST 1200620 is a singleton


Sequence

>1200620 (1 EST) Length=368 TTAATAATTAAATTAGTGTATATACTACTTATTTTATTCGAAAATATATAACCTAAATATACATACATATATAATACACA TATATCAATTTTGTGTATATGTCTCCATTTTTTTTATTTAAAAAAAAATGCAATCTACAAACCTGCACTTCCACCAATAT TTTCTAATTCATTGTCAGAAAAAAGTTCCTCTTTCTTTCAAGTATAATAAATTATGAATAAAAATAAATATATAAATAGG TAAATTTTTTTTTTTTTTTCAAAATTATATAAACATTTAGAGTAGGGGGAAAATCATTCATTTATATGTTTATTTAAGTA GAGAATATATTATACACATATATAAGAGTGCATTAAGAAAAATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200620: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006202320862AA5506101782m3gmbPfHB3.1, G. Roman Reddy


Date: 6:25:52 on Thu 23 Nov 117.