EST 1200621 is a singleton


Sequence

>1200621 (1 EST) Length=361 TGTACTATATTTTTCTCTCATCAATTTATAGATGTTATTAACAGCCATTTTAGTAATTCATACAATATACAAATATTATA TGAGTTACACACACAATACTTATATTGAAAAGGAAGAAAAAAGCGAATAGGAAAATGAAAAACAAAAAAAAAAAAAAAAA AATGAAAACATTAAGAATATTAACATTGTTTCATTAAAATGTACATAAATTGTGTATAATGTCACAGATTTGTAGTTAAT ATAATATAATATGTATATATGTTTAATTGTATATTTTATGATTCTGTAGTTTAGTTTATAATGTAATTTTTTTTAATTTT TTTTATTTGTAGTGAGGTAATGTGTGCTAATATTACAATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200621: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006212320863AA5506111783m3gmbPfHB3.1, G. Roman Reddy


Date: 8:21:41 on Wed 22 Nov 117.