EST 1200624 is a singleton


Sequence

>1200624 (1 EST) Length=736 TATAATGGGGAGAAAAAGAAACAATATTGTAAACATTAGATATAATTTTTTCTTGATTTATTTTTGGGTGATATTTATGT ATCCATGCGAGACAAATAAAGGAAATGTGAAGCCACTAAATTTTATAAAAGGAAAGAATATTTTTTTGAATATAACTAAA AACAAAGTGAAGCATTTAAATACAATAAATGGAATTGAAACTATATCGAATGTTGAGAACAAAAATATTTTGAATGATAC AAATTATATAAATGAAATGAAGAATATAAAGGTTAGAAGAAATATAAGTGAAGCTTTACATATGGCCATATATGAAGAAA TGAAAAAAGATAAAGGTGTATATGTACTTGGAGAAGATGTAGGATTGTATGGAGGTTCGTATAAAGTTACTAAAAATTTA GCTCACTTTTTTGGTTTTTCTAGAGTTTTAGATACACCCATATGTGAAAATGCCTTCATGGGATTAGGTATAGGTTCTGC AATTAACGACTTAAGACCTATTATTGAAGGTATGAATTTGTCTTTTTTAATTTTAGCATTTAATCAAATATCAAATAATG CTTGTATGATGAGATATATGTGTGATGGTCAATTTAATATTCCTATTGTTATTAGAGGTCCAGGAGGTATAGGGAAACAA TTAGGTCCTGAACATTCTCAAAGAATTGAATCGTATTTAATGAGTATACCAGGTATTAAAATCGTTTCATGCTCAACACC TTTTAATGCTAGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200624: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006242320866AA5506141786m3gmbPfHB3.1, G. Roman Reddy


Date: 7:3:46 on Mon 20 Nov 117.