EST 1200626 is a singleton


Sequence

>1200626 (1 EST) Length=655 ATAATAATTTTTCATAGGATTCTTTACATTTATTTGTTAAATAATTTATTTCATTTTCAAATATCAAATCATTAAATGTT TTCTCACCACATCTAAATATATATACATTATTCTTTGTTTCTATAGAAAAATTTATCAAATTATATAACTTCATAATAGC ACTATTTGCCGTATCAGTATTAAAATTAGAATCTTCTATAGAATCTCCTGCATCTGCTAAGGCAATTCTGGTCCCATCAC TAGTATATAAAGCTATACTTTCTTCTAAGGTTATAAAATTACCTTTACTCTTAGACATTTTTTCTTTATTCACTAAAACA TGTCCATTACAAAAAAAAGAACGTGGGAAATATTTTATTTTCTCATAACTTGATAAATCAATATTTTCTAACTCATTTAA TATTTCTGTTTGTCTATCTAAAATACTTCTTTCTTCCACATCTTCCTTATTTCGATCATATTTTTCTTTTTTCCCCCATA TAGCAACATGATTAAATAAAGCCATTGTTAAATGATTAAAAATTAAATCTTTACCAGATATACGTACATCAAAAGGATAC CAGTAGGTAAATTCTCTCCTCATTCTTACTAATTTCTCCTTAGATATATGTTTAGATATATTACTTGTATCATCACTAAT ATCAAAAATATAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200626: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006262320868AA5506161789m3gmbPfHB3.1, G. Roman Reddy


Date: 18:55:12 on Sat 18 Nov 117.