EST 1200627 is a singleton


Sequence

>1200627 (1 EST) Length=602 AAGAAAGAGCATAAAGAAGTAGATGACATGATCCATAATATGGTCAAAATATTTATGGATAAACTTATTTATTATTGTAC AAATCCTATAATTTTTTTAATGCAAAGAAATGATAGTAATAGCTTATTTGATAAAGAAATAAAAAACCATATTAATATAT TTATCAGTAAGACCTATAATTCAGAAAAAGAAATTAGAGAATAAAAATAATATGAAAGAGAAAAAAGATGTTTTTTTAAT ATTTTATTCTTTAACAGAACAAGTAGAACAACATAGTGATACAAATATTTTAATTAAAAATTGTATGAATGAATTATTAG GAAAAATTTTCTATTTTATACCAGACCGTAAAATATTATTTCTACAAAAAGAATATAAATATATATGTTTTATTTTATTA TCATTATTTTTTTTTTTATTTATTACCTACCTATAAATATATTGTTATTTTGCACACACACAAAATAATTACCTGACTTT TGGCTATTTTTTTTTTTTTTTTTTTTTTTGGAAAGCTAATGATATGGCTAGCTGGATTTCTAGGCAAGCTCTTGTCGATC TGCTAAAAATTATAATCGACGAGAATGAAAATAGGAATGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200627: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006272320869AA5506171790m3gmbPfHB3.1, G. Roman Reddy


Date: 0:56:30 on Wed 22 Nov 117.