EST 1200628 is a singleton


Sequence

>1200628 (1 EST) Length=672 TTGAGGGGTACCTGCACATTTTCTTTTTATTTCATTTGAAACAGATCCAAAGGACATGCTAAAAATTTGATAACCACCTG AATCCGTCAGAATAGGAGAATTCCAATTCATAAATTTATGTAACCCACCTAACTGAAAAATAATATGAGGCTTGGGTTGA ATAAGTAAATGAAATGTATTCGATAATATAACTTGTGTATTACATTTTTTAATAAAATCTATTGGTGTTGATTTCATACA CCCTTTTGTTGCACAGAAAAGAAAATTGGGTGTTTCTATATCACCCCTTGGAGTTTTTATTATACCTATTCTACTTTTAT CTTGTTCATTATTATTTTCTTTTAATACGCTAAAATCAAATCCTGGATAATTAAAATGGTTATATATTTTATTGGAAAAT AAAAGTTTTTTTTTTTTAACATAAGTAATAATACTTTTATTGTGATTAACAACATGGGTTACTTTAAGGTTTGTTATAAA TGCATCAAGGTTTTTATATTTTGTGCGTTTATTATATTTTCGTTTTAAATTTATTAATTCGATATTGTGATCATTAAATA AAATTACCTTTCTATTTTTCACCTGTCTTTTTAAAAGATCATTTTTGTGTCTCCTATTGGGTAACATGCAATTTTTGTTT TTTAGTTTTTTTTCATTGTAGACAACATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200628: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006282320870AA5506181793m3gmbPfHB3.1, G. Roman Reddy


Date: 14:46:29 on Sun 19 Nov 117.