EST 1200635 is a singleton


Sequence

>1200635 (1 EST) Length=515 CTTTTTCATTTTCTTGATTATACCTTTCATCATTATTTTCTTCCAAAAAAATGGTTTTGTTATTTATGCCTTTATATGAT TGTGCATCATTATTATTTTTTATTTTATTAACAAATATATTATTTAATTCCTTTTCATGTGCATCTCCAGGCCATTCATT TATAGGGACATTATTATGATCCATATGTTTGTCGACAGGACTTTTCATAGTATTATCATGTTGTATATTATTGAAGCCAC TTGATTCTTCTTCATATTCTTTTTTATTCTGATCAGTAGGTGTATTATTATATACATTATGATGTATATTTTGTATGTCT TGTCCTTCACCAAAATTGTCATTATTATTTTTAAAAAAGATATCATCANCTTGATCTGATCCCACAATATTATTATTTTG GTTAATATTTTGAATATCCTTTTTATGAACATTTTTATTGCTAATGTTGTCATTTCTATTATTTTTGGTTGAATCAATTG GTTCCTCATCTACATAAGTATTTCCTTTATTACTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200635: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006352320877AA5506251812m3gmbPfHB3.1, G. Roman Reddy


Date: 10:35:57 on Sat 18 Nov 117.