EST 1200638 is a singleton


Sequence

>1200638 (1 EST) Length=288 TTATTATTATTATTATTTATTATGTCCTCATTAATATTATCATCTAAGGAATTATCATTTTTATATTTAGTTTTACTTTT TCCTTTAGTTTCTATTATTTTTTTATACCATGAATCGCTTTTTTCCCTCTTTTCATTATTTTCATTATCTTCCTCATTAA ATGATTCTTTGCTTACTTTATCTGAACTAGCTTCTTTTTTCTTTTTCTTATTTTTGAACGTGAATACCATATCGAGCACG GCGTGTGGAGTTACAAAGAGGAGAACCTCACAGTAATCATATGGTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200638: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006382320880AA5506281816m3gmbPfHB3.1, G. Roman Reddy


Date: 18:37:12 on Sat 18 Nov 117.