EST 1200646 is a singleton


Sequence

>1200646 (1 EST) Length=375 TGTTATTATATATATATTATATATATATATATATATATATTTTTTTTTTTTATTTTTTATTTTTTTTTTCCTAAATAAAA ATTTTAGTTATCATATTGCTGATGAAAATGGTCTACTATTATATTCCTTCAAATTTAATGATTACAAGTATAATAATCAT GTTAATAATAAAATATTTTTAAATGTCATGAACAAATATATTCAGAGCACTATGTTATTAGTTTCGCTTTGCCATCCTTT AAAATTAGAAAATAAAAATGAAGACTTCTTCGAAAATTTAGATGATGAGGATATAAAGAATGATGTTATTCATAATAACA TGATAAAAGAAATTAATAAAAAATGATTTTAAAATTAAGTATAAAAATGAACAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200646: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006462320888AA5506361825m3gmbPfHB3.1, G. Roman Reddy


Date: 12:49:47 on Sun 19 Nov 117.