EST 1200647 is a singleton


Sequence

>1200647 (1 EST) Length=282 TTACATTTATTTATATTTTCCATTTTATTCCCATTTTGAAGATATATATTATTTTTAATTTCGAATGTAAAGTTTGAAGG GAATTTATTCAACAAATTAACTAATTGTATAAATTCTTTTAATGTATATAGATTTATAGAATAATATATTTCATTTATAA AATAATTAATAATTTTTTTACAATCATTTAATAAGTACATATTTTTTTTATTTATATCTGTAAAATGATCGCACTTCTTA ATCATTTGAACTGTATTACAAAAAACATTAAGTATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200647: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006472320889AA5506371826m3gmbPfHB3.1, G. Roman Reddy


Date: 21:45:13 on Mon 20 Nov 117.