EST 1200650 is a singleton


Sequence

>1200650 (1 EST) Length=451 TTTATTATTATTATTATTATTATTTTTTATTTTGTTTTTTCCATATTGTTAACAAAAAAAAAAAATATTCTTACATCCAT ATCATCTTCATTTATTTTTTCATAATTTGTTATAACTTCCTTTGGACCTTTATACTTATTTTGCATTTCGAACGGTTTTA ATTCCTCCTCTTTCTTCTTTGGCATTTCAATTTCATGTTTCATCTAAATGGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ATATATATATATATATTTATTTATTTATTTATTTATTTATTTATTTATTTCCCTCTNACATATTTTTATAAAATATATTT CTCCTTACCATTTTGGAGCCAATTATTTTCATATGCAATAGCCTTGATTCCTCATCATCCTCTTGCTCCTTATATTTTTT CTTCATACGCTTTTTCTTCGTTCTTGCCCCTCTTAATAAATCAAGCTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200650: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006502320892AA5506401829m3gmbPfHB3.1, G. Roman Reddy


Date: 15:39:44 on Fri 24 Nov 117.