EST 1200657 is a singleton


Sequence

>1200657 (1 EST) Length=704 CTACTACTTCTTTAGTACTACTAACTTAGTATTACTAACTTACTACTACTTCATTACTACTTCATTACTACTTGTAGAAC CACATCATTACTACTTGTACAACTACTTCGTTACTACTATGTGACTACTAACTTACTACTACTAACTTACTACTAACTTA ATACTACTAACTTACTACTAACTTAATACTACTAACTTACTACGACATCAGTATTAATTCTACAATGACATTACTACGTC ATCACTACTAACTTACTGCTACATTACTACGACATCATTACTACTTCTACAACTACTTCGTTACTACTATCTGACTACTG CTTCATTAATACTAACTTACTACTAACTTAATACTACTAACTTACTACTAACTTAATACTACTAACTTACTACGACATCA GTACTGCTTCTACATCGACATTACTACTTCATTAATACTAACTTCCTACTTCATTACTACTACTACGAAATCATTACTAA TTCTATAATGACATTACTACTAACATGACTAAGAACATTACTAACATGACTACTAACATCATCACTAACATAGTAACTAA CAACATCACTAACATAACTCCTAACAACATCACTTACATGACTACTAACAACATCACTTACATGACTACCTACATGACTA CTAACATTACTACTTACATGACTACTTACATGACTACTAACATAGTGACTAACAACATCACTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200657: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006572320899AA5506471836m3gmbPfHB3.1, G. Roman Reddy


Date: 16:40:28 on Sat 18 Nov 117.