EST 1200658 is a singleton


Sequence

>1200658 (1 EST) Length=700 TATACATTTATGTATGCACATATAACATTTGCATTAATATACATTCAATTTTTACATTCCAATAACTTATACTCGTGCTC TATGATTTTATAATTAAGCATATAATTAACATTGTATTGAACCCTTAATTTGAAGGGATATTGTTTATATTTTAATTCTA TATAATTCAATAATAAGATATGATAAAATTTATTTGTTAATTCGAGATATTTATCTTGATAATTATAATGTATTATATTT ACATCGATTAACCCTAAAAGTATAGGATTGTTTAGATTAATAATATTATAACAAAACACTTTTTGTTTTTTTAAAAAATA ACGGATGGTTTCGAAAATCGTAAAATAAAATTGTATAAAATTTAAAGGTTTATTATTTTGTATATGATGTTCATGATTAG ATTTATTATCATTTGTTTGTTTTATTTTATCATCATCATCATCATTATTATTATTATATTTGTCATTTGCTTCCTTATCA TATTGATTAATTTTCATTTTTTCTATATTCGGTAAAGAAAAAAATTGTATGATTTTTTGTTCAAAGTTTAAGATAAAATT ATGTAATACTTGTTCACATAAATCTTTTAAAAATAATTTTTCTTTTTCATTTTTTTTATATGTTATAATTTGTTCTATTG TTTTCTTAGGCGAATTTAATATATCCTCTTCTTCTTCGTCCATATCATAAGTAATATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200658: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006582320900AA5506481837m3gmbPfHB3.1, G. Roman Reddy


Date: 23:24:18 on Sun 19 Nov 117.