EST 1200664 is a singleton


Sequence

>1200664 (1 EST) Length=425 TTTATAGATGATAAGTTATTATTCTTTTTTCCCCTCCCATGTATATACAATAAGATGATTTACAAAAAATTGAGAGTCCA CATGTTAGTATAAAATATTATTCGCCTTATATGTTTACAATTTCATTTGTTATTTATTATTATATTTTGGAAAATAATTC ATTTCATTTTTTTTTTTCTTTTTTTTTTTTTTTTGAACAATGCAAAATTGTGCATAATAAAAAAATCACAATAAAATAAA AAAAAAAAAAAAAAATGAAAATAAAAAAAAATAAAAAAAATGAAGATAAAATAAAAAAAAAAATGATAATAAAATGACAA AATAAAAACAGAATAACAACCACATATCTTATTAACCCTTTCATATATCATATATGAATAAATATTGGGGTTTGCTATAA TATATATATATATATATATTTATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200664: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006642320906AA5506541891m3gmbPfHB3.1, G. Roman Reddy


Date: 12:42:47 on Sat 18 Nov 117.