EST 1200670 is a singleton


Sequence

>1200670 (1 EST) Length=575 TATATAAGTATCATATAATTCCTCATTTATATTACACTTTATTTCATATTTTTATTTTATTAATTAAACGTATCCTTATT TATACATTAAATGGTACCTTTTCTTAATCTTTTATCTCTTATTTCATCTACAAACTGTTTTAGCATTCTATTTTCAAATG ATTCTATAGCTCTCCTTTCAACTTCTTTTTCCACGTTTTCTTCAACTGCCTTTTCAATGTATTCCAACATTTCAGGGGTT AATAAATATGGTCTTTCATAATCATAATAAGAATTATATAATCCCGGATGTCTTGGATATAAATCTTCTTCATAATCTTC ATAATCATCATAATCCTCAGTATCATCATTATCTTCGGAATCATCATTATCTTCAGAATCATCATTTGCACCTGCAACCC CCCGGATTTCCTTTTCGGTATTTTTTATTAATTCTTGATCCCTTTCTTTTTGTTTTCTTTCTTCCTGTTCTTCATCATAC AAGTCTTCATCAAATTCAGTATTCGCCTGTTTTAATAAATTAGGAAATGGGCGTTTTTGCAAGTAACTAAATCTGGATTC TTTTCATAAAATTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200670: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006702320912AA5506601897m3gmbPfHB3.1, G. Roman Reddy


Date: 16:27:19 on Sat 18 Nov 117.