EST 1200672 is a singleton


Sequence

>1200672 (1 EST) Length=562 TATATTTTTTTATTTATATTTGCTCTTATTATTAGTCATGCTATACACTCCTGTTCATAACAATTTTTTTCATTTCTTCC TTCTGTGGACATTTTTTTTTCCCCCAACAAGAATTTTTGGATTTTTCAAGACAGCGACTTTTCCACTTTTCAATTTGGTT CTAATAAAACAATTGGATGTATCATAAAAATTATCATCATTAAAAGGATCGTTAATATTTTTTTGTGATTCATATAATTT TTTTTGATGAGATATAAATTGTTTCCTTCCTCCTATTAACAATTCATCTTCTCTAAAAATTTGTAATTTATCTTCAAATT TATTTTTATTATTGTTATGATATTTTTTTTTGGGTATACTAAAAATTGTATATTTTATATTAACTCTTATATGTGGGATT TTAACAATTAACTTTTTTGAATCATTATCAACATGAACATTAACCTTTCTTAGATTATTATTTCCACATTTCGAACAAAA TAATAAATTATTTGTTCTCATAAAAAAATAACAAGATGTGCAAAAATAACCCCATAATTTTATTGAATTTATTTTATAAC CA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200672: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006722320914AA5506621899m3gmbPfHB3.1, G. Roman Reddy


Date: 2:22:22 on Mon 20 Nov 117.