EST 1200675 is a singleton


Sequence

>1200675 (1 EST) Length=698 TATATATATACATCCTATGATTCTTCGATTTTTTTATGAACCAGCTTATGAATAAAACATAAAAAGTTTACATAACTATA TTCCTTCTCAACTTTATCCTCAACACATAATGAAATAAAGTGTTCTTCCAATGACGATCTACAAAAGGGCAAAAAAATAT GCACACATAAATATATATNCATTTTTTTTAATATTTCCCTTTTAAAAACTTTTTTGCCTCACAAAAAAATAAATAGAATC AAAGAAAATAATTATCCTTAATAACCTGNGAAAATAAAAGAGGAACCAAAGCTGCAAAATGAAAAATTTTTAAATATATA AATATCTTAATATATATATGTGTATGCATATATACATTTGTAATGTTTTATTATTTCTTTATATTTTATGAAGTATTACC ATATTTGCACCTATATATTGATAAAGATAATGTGAATGTATTAAAAAGGTTAAACATTAGAGAGGTTAAAATAAATTTAT TTGTTTTTTTTTTTTCATTCATATTATTAAGAATCGATTTTTGTATCAATATTGATGAATTTATAAGTACATTAGTATAA ATACTTTTATTTATATCTTTAAACATATAAAGATATGTTTTTATATTATATTCTTTTGATTTCAGATTATGTAAAACAAA TGAAAAAATGAAAGTATATAATACAGTATTCTCCAGAAATTTCCAGTAAATTTTATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200675: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006752320917AA5506651902m3gmbPfHB3.1, G. Roman Reddy


Date: 13:46:44 on Thu 23 Nov 117.