EST 1200679 is a singleton


Sequence

>1200679 (1 EST) Length=694 TCTTCATGTAAAAAAAAATTAATGTAAAAATAAAATAATTAAATAATAATATAATAATAAAACAATATAAGGTAACAATT TATAGAAATCTAATATTTAAAAATAATTATGAATAGAAGATAATTGTATATTAAATACTAAATGCATAATGCATTAAATT ACATTTAATAGATGGACATTATTATTTAGTTTTTTAATAATTTTATGTATTGTAGTTTTTTTTTCATTTTTTTTTTTCGT CTATAACGTAAAATTAAATAAATGATTAAAAGTAAAACGACTATAATTATTATTACAATAATGGAAATTCCTATAGGATT AGTAAAAAAGTTAGAAACAATTGTTGACGTAGCAGAGGCAGCATCTTCTCCAACTTTGGTAACTGTTGTAGCTTCCAAAC TAGCGTCAGCAGCTGCTTGTGTTGCCTTTTGAGAAATTATTTTTACAAATTGATTTTGTTTACTCTGCATACTTAGTTTA GCAACACAAAAAGTACTATCATCGACTGCGTTACCAACTTCACACATGTCACCAATTTCTTTTAAAATAGCAAAAAGGCT ATTTGCTTTATCATATGTGCTTCATTAACTTTTGCAATCCAATTAAAAACAGTTACTTCATGTAGATAATATATATTTCC TAATTCGCAACTGCTTTGTTTATACCAGCAGCTTTACCTGCTTCAATAGCAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1200679: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006792320921AA5506691906m3gmbPfHB3.1, G. Roman Reddy


Date: 4:39:2 on Thu 23 Nov 117.