EST 1200681 is a singleton


Sequence

>1200681 (1 EST) Length=643 ATATATTTCCTTTATGGTTTAATAACTTACGTGCGTGTCCATTTTCTAAAAATCGATCGAGGTAATAACAAATTATACTC AGTATTATCTTCATCCAAATTTATTTGTTCATTTTTGATACTACGATCATCATAGTTAGCATATATATTATTTGAATAAT CAATATTTAATTCGTTTAATAATTTCTTTCTACTATTTATTAATTTTCTTTTACATACTTTAGAAGCATACATCATAATA TTACTTTTATATTTTTCCCATTCATTTTGATGTTCATTTTTTTTTGTTTTATAATTTAAAAATAATTCATCTAGTGTATT CCAATCAATACCATAGCTGGAACTATAAGACCATAAATTTTCTAATCTCTTTTTATTTCTCTCTATATTTTCTTTATCTC TTTCAAAATTGTCATTTAAATTATTTGTATTCTTCTTATTATTCATATCATTTACATTTTGTTCTTTTCCTTTCTTCAAA ATAAAAGGTTGCAAACGATGATTATATACCAACGGATTAGGCCATAAAACATTTCTTTCAGGGTAATTATAATTTTTAAA AGTTGATGATAAATAATATATATCATAATTTTTTTCATCTGGATTATTATGAATTTCATTTTTACCATTATGTATATCTG CTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006812320923AA5506711908m3gmbPfHB3.1, G. Roman Reddy


Date: 1:23:50 on Mon 20 Nov 117.