EST 1200682 is a singleton


Sequence

>1200682 (1 EST) Length=636 TATTGTGGTGCACCGTTTACGTGGAAGATGAAAATTGTTCATAATTATACATGAAGACAATATTTCTTATAAACTTTTTA TATATTAAAAAAAATGGATATATATAATTCAATTTATATACGCATTTTACAAACCTTCCATTCATTGGCCAATGTATATA TATCCTTTTTATCAACTTTTTTTAACACAGGAGTTAATAGAGAATCTGGTAATCCTAATGCATTTCCTATATTAACATCC TTATTATATAATATTTTTCCATTATCTTTATCAATATAAGTAGAGTATATCAAGGGATGATTTAATAGTACAGATGATAC ACATTTATTTATTATAACACTCATACTAATTTTTTGTTTTACTTTTTCATATAATTTCAGTAATTCGTTTGTTTTTATTA AATGAGTAACACGGAACACTGGAACGGTTAAGGTAAGCATCATATTATTTTTTATTGATTTCTGTATATTTGTCATATCG ACAGTTTTTGGATCTCCATATTCAATTGTTTCAACTTTTGGTTTTTCGCAGTAAGTAACATTAGTAGAATTATTTTTATG TCCATTTAAAAATGCATCAACGTCTTCATAGGTTATACGATTGGGTGTTTTCCTGTTTCTATAAAAGGTATAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200682: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006822320924AA5506721909m3gmbPfHB3.1, G. Roman Reddy


Date: 21:18:11 on Fri 24 Nov 117.