EST 1200684 is a singleton


Sequence

>1200684 (1 EST) Length=659 TTCATAATAGTATATGTCTTTTTTCGTTTTTTTCTTTCTCCTCTATTAATAATGCTAAAATATGGATTTTTTACGAATTC TTTCTTATTATACATTGTATATAAAAGAGGTATCCATTTTTTCCTTTTTAATAAAAATTGTATACTTGAAAATGGTAACA ATTTAATTAGAGCCTCATACTTATTTTGAGTATTCATTATTAAATTATATATATATTTTTTTTGTTCTTCCTGTTTTATA TATAATTTTTGATATATGTCGTTATCATAATATTCGGATAATTTCTGTTCATGATTTTCTTTTAAGACTTTAATGAAATT AATAAAATTGATATACTTTTTATTTAAATATTTATATCTAGTAGTTATATAAAATCTGTTCATAAAAAATGATGATTGCA TTTTATTTTTTAACATATTAAAATGATATAATTCCTTTTTAATATGTTGATTAAATAAATAATATAATACAATCAATATG TTGTAATAGACATTTTTATGAAATATATGATTATTTTTTTTTTTGTATGTATGTGTAGATTTGTTATTTTTTATATTGAT ATATATATTTTCATTATGTTGATCATCCATATGATTCTCTCTTTTTATGTTTTCAAAAAATTTATCTCTTTTACTACTTT TATAGGATGAACATTTATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006842320926AA5506741911m3gmbPfHB3.1, G. Roman Reddy


Date: 11:50:26 on Wed 22 Nov 117.