EST 1200685 is a singleton


Sequence

>1200685 (1 EST) Length=628 ATATATTTATTTATTTATTTATAAATGGAAATAAGTCAAGGTTAACATTTTTTTTTTTTTTTTTAAATTATTATGAATAA AAGGAAGGACTTACATATAAAATGATTATAAAACATTTAGTGACTTGATAATTTAGAGTAATATATGAATTATGATATAA TATAAACATATATATTATATATTACATAAGATAAAACATAATAGCGTGTAACCTTTTTTATTCTTTATGTAAACACGTTC CCTTTTCACTCGTGATTCTTGAATATGGTGGTTTTTAACCTTGATGACGTTGAGATTTTTTTCCCGTACGATTATATTTA TCCTGAACAATATGCATATATGAAATATTTAAAAAAAACGCTAGATAGCGAAGGACATTGTGTTTTAGAAATGCCGACAG GGACAGGAAAGACGGTGGCTATATTTTCGCTTATTACATCGTATCAATATCATAAGAAGGATGAAGGGAAATTTATTTTC TGTACTCGTACGGTTGCTGAAATGGAAAAGTCGCTAATAGAATTGAAGAAGGTAATTCAATACAGAATTAATGTAATGAA GCAGAGAAAGGTAGAAAAGTTAAAAATGAAAAAGATGATGTAAATGATGTGATAAAAAATGACGATGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200685: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006852320927AA5506751912m3gmbPfHB3.1, G. Roman Reddy


Date: 10:47:13 on Tue 21 Nov 117.