EST 1200687 is a singleton


Sequence

>1200687 (1 EST) Length=609 ACATAAATGTCTTTCATCTTCAAGGTAAGAATCCAAAAGTTCAGAAATCAGTTTCATTTCCTCTTTATCATATACTACTG GATCTCCATATTCTTCTAACAAAAGATTTGTTTTAGATCCCCCTTTTTTAATTTCTTCTGGTTCCTCTACATTATCACAT AAATGAATAACATTCCCTGGATAATTTTCTCTCTTACAATCATCAAAAAATTCTTTTAAAGATTTTTCACATTCTTCAAC ACTTACTGTACTTTCGTTATCATCCAATTCTGTTGATGAATTTTCATCAGGATTTTTCTCTAATTGAACAGTTTCATTAT ATTCAATCAATAATCTTTTAAAATATATAATTAATGAGTATCTTGTTTTGTGTATATTATGTACTTTGTTATGTAAATTA ACCTATAGGGAGAAAAAAAGAAAAAGAAAAATATTTATATACATATATAAATAGTGTGGGGAGTAATAATCTTTGCAATT ATTTTATTTTTTATTTTTTTATTTTTGAAACATTTTTTTTTTCCTTTTTTTTTTTTTTTTACTACCAAAATTAGAAGATA TATATATTTAAAGAGAAAACAATGTGTACAATTTTTATGTATTTATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200687: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006872320929AA5506771914m3gmbPfHB3.1, G. Roman Reddy


Date: 9:25:49 on Sun 19 Nov 117.