EST 1200694 is a singleton


Sequence

>1200694 (1 EST) Length=595 GAAAAAATTTTATTGAACAATTACAATATGTTTTTATATGTATACTTATACATTATATGTGATAATATTATACGTTGTAT TATATTATAATTTTTAATAAAATATGCTTAGTAACTTTTTTTTATCAAAAGTTTATCAAGGGTTGGATTTCCATAACTAG CATCAAAAATATGAATTGATTTTTCATCATCACAACTTAATGTCACGGTTTCATTTAAATCTGAAGTTATAATTTTTATA TCACCATTTTTTATTTCTTCTTTTTTTTTTAAACAACTTACGATTATTGTATAATTACTCAAAGTAATAATTAATACAAA CAAATTTATAACCCAAAAATAATCCATTTTCATACAAAAAAAAAAAATAGATAAAATAATAATCAAATAATTAAACGCAC AATAGGAAAGGGTCAGTCAATGTATAAAAATATTTAATTTATATACACAATGTTGGTAAGCAAAGAATTATTTATTTCTT TTTTCTTTTTTTTTTAATTCTCCGAATTAAATATATATTTTATACTCTCAGGTTACTTAGTAATTGTGCAACCACCTATA TTGAAAAATGTGTAAATACACAAATGTTTATATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1200694: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006942320936AA5506841921m3gmbPfHB3.1, G. Roman Reddy


Date: 8:41:49 on Fri 24 Nov 117.