EST 1200697 is a singleton


Sequence

>1200697 (1 EST) Length=588 TATATATATATATACAAATTTTTTTTAATAGTTAAAAAAAAAAAAAAAAAAGAATTAATTAAAAACCACATTTTTTTTTT TTTTTTTAAACTAAAAATTTTATTTTTTTAAAAAAATTATTTCTTTAAAGAAAAAATTAAAATTTTTCCTTTCTATTTTA ATTTAATTATAGAAAATGTTGAATATTTTTAATATAATTTTCTTGTTGTTTTTAATAAACATATATATATGTGAAGCCAA TGGAACACTCTCTGAAAATATTGAAAGTGCTGAAGAGATAGATGCTTTAAAAACGAATTTAAGAAATGGATATTTAAATA ATACTTATTTTAATGAAGAAAACAATAATTTAAATATAGAAAATGAAATAAATAATACAAATTATAATGAAGTAACAGAA GAAACTAAAGAAGAATTATATGATATAAATGAAAATATTTTCCCTGATTATTTTTTTCTTGATATCTTTACTGAAAATAA AGAACAAAAAAATGAAGAAGTACCAATGAAAATAGAAGTAGTAAATGATGGAGAAGAAGTAAAAACAGAATATGTTTCTG AAAAAAATGAGGAAGTAGAAAATAAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1200697: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12006972320939AA5506871924m3gmbPfHB3.1, G. Roman Reddy


Date: 17:22:53 on Fri 24 Nov 117.