EST 1200703 is a singleton


Sequence

>1200703 (1 EST) Length=643 TAATTACTTAAAAAAAAAAGAAAAGATTATTTATTAAGTTAATTATATGAATTATTATTTATATTTTTTATAAGAAACTA TCCAATTTTTGATATATTTATTTCCTTTTGAAAAATTTGAGAATTCTTTTTTTGAAGAAATTATCTTCTGAAGGATATTT TTTACCTTCATATTGTTCACACACACTTTTTACTTTATGTTTCCATCTTTCAAAAACAAAATTTAAAAAATAATTATAAT CATGAGAAGTATTAATAAACCATTTCTGAATAAAAGTTTCCTTTTCAACTATAGATACATGTGGTTCATTTAATTTATCA TTAATAAATTTATAAACGTTTTCTAAATAAAGTGCCCATTTACTTTCCCACATAAAATCTCTCCATTTATGATTCATATT ATCTGTTTTAATCAAATATTTAACTTCCATTTGTTCTAATAATAGTTTCCATATTTCTGTTACCCTTGTAGTTAAATTAT GAACTTTTTCGATTTCTTCTGAACATGTAGAATATGGTATTTGCTTTTCAGTAGGTAAATTTAATCTCTCATAACTTTTT TCGTTTAAGGTTATTTTGAAATCTTGTTTCCATATAACATCTTCCTCTTTCAACAATTATTCTTTGATACATATATTTTT TTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1200703: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12007032320945AA5506931930m3gmbPfHB3.1, G. Roman Reddy


Date: 23:18:46 on Fri 17 Nov 117.