EST 1200705 is a singleton


Sequence

>1200705 (1 EST) Length=100 TTTCCATATTTTATTTTATTTTTTTTTTTTTCCCCATNATATTTAGAGTAATGACTTTCATATTTATTTCTACTAGTAGT ATCGAAAGAATATAAATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1200705: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12007052320947AA5506951932m3gmbPfHB3.1, G. Roman Reddy


Date: 6:5:37 on Thu 23 Nov 117.