EST 1200706 is a singleton


Sequence

>1200706 (1 EST) Length=573 TACTAAAGGAATAAAGTTCTATAATTTTGTTTATACTTTATACTTTATTTATTATTTATTATTTTTTTTATTTTATATTA TATATATATATATATATATTTTTTTTTTTTTTTTTTTCGTATAGGGTATTAACGCGTTAAATTTGGAACCGGCCTTGCCA AAACTTGATGAAAAAACACGAACGGAATGGATAATGTTTAAAAATCAGACAAAAAATAAGGAATTACATAAAAAAGACAA AACAACAGAAAAACAAGAATTTATCACGGCATCGAAAGAATTCAATGAGAAATTAACGTAGTAATAATAAAAATAAAATA AAAAAATAAATGAATTATAAATATATAAATAAATAATAAAATAAATAAAATATCGAAATAAAACGAAATAAAATATTTTG ATAATGATCATATTACAATTACATTCATTTGTCATGTTCACTCTCCAAATACGCATATTAATAAACGCACACATAAAAAT CATATAATCATATAAGCACATAAACATTACAAGCATATATATATAATCTCACATACATACAAAAAAATAAAAAAAAAAAT ATAAAAAAATAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1200706: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12007062320948AA5506961933m3gmbPfHB3.1, G. Roman Reddy


Date: 2:58:27 on Mon 20 Nov 117.