EST 1206389 is a singleton


Sequence

>1206389 (1 EST) Length=584 GGCACGAGGTTTTTTTTTTTTTTTTTTTGGAGTGGAAATGCCAAAAAAGCAAAGATCCAAACACACACAGGCACACAAAA ATAAAATAAAAATGAACAAATCAACAACCCAGACGACAACAACAACAACAACGTGGTTGCATAAAAGTTAGCGTTGCTCT CGATTTTCATACGTCCAGAAGGAAAGACAATCAACAAGAAGAGCAACAAAGAGACCCGCCTGTGGGGCATTTATGAATTC TTCACGAGATATGCAAAGCGGCTCTGCCGTGGAGATGAGATCAAATGCCTCCTGCACGACTGTTTCCCGTGAGGGCACCT CAATTCCCGCTGCCACCAGTTTCGTGTGTGTTTCTCTTAAAGAATTATTCACATGCACGGGTTTCAAGTTACCACNCCCC NCCATGTTCTAGGATATTCCCAAAAAAAAAGCGCCGCAGCTTATCCCCNTTAATGAGGGTTTAATTTTACTTGGCCCTGG CCGCCCTTTTACACTTCCTGAACTGGAAACCCTGGGTTTNCCCACTTATCCCCTGGACAATCCCCCTTCCCCACTGGGTT TTTACAAAAGGCCCCCGATTCCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1206389: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12063892327468AA556016TENF0109T.cruzi epimastigote normalized cDNA Library


Date: 22:6:20 on Sat 18 Nov 117.