EST 1206396 is a singleton


Sequence

>1206396 (1 EST) Length=242 ACTCTTTGAAACAGAAGCGGAAGGAGAAGGCCGGGAAGTGGGCGGTGCCGATTGAAAAGGTCAAACCCGTCAGCGAGGAT GAAATGATGAAGGCCGTTACGTCCGGCAAGCGCGGAAAGAAGTCATGGAAGCGCATGGTGAATAAAGTAACATTTGTCGG CGAAANCTTCACGCGCCCGTTTGCCAAAGACGAACGGCTTCATTCGGCCCATGGTTCTCCCGGTTTAAAATTGGCCCATG TG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1206396: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12063962327475AA556023TENF0022T.cruzi epimastigote normalized cDNA Library


Date: 23:58:28 on Sat 18 Nov 117.