EST 1206399 is a singleton


Sequence

>1206399 (1 EST) Length=311 GACGANCCCTGCAGACTGGCATTACAGCTCAATACCATTTCTTCGCTTCAGGAAACGCTTGCACCACACCCAGGCCTACT TGCCCTCGCAAATGCTTCTGCAGGCCACACAACACCTCTTTTAAATGTCGTTCCAGAACGTGTCCAGCAAATCACGAAGC AACTTACAGCTGTGCTTTCTCAGTGCGCCTTACGACACTACTTTTGCCGACGGCCACAGAACAGTTTGACACCGGTGGGT AGCGGGTGGNAGACGATTTTGGCCAGTAGCTGCAGTATTGCCAAGTGTTGGTTGCGAGAGAAGCCCTTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1206399: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12063992327478AA556026TENF0025T.cruzi epimastigote normalized cDNA Library


Date: 10:0:55 on Fri 24 Nov 117.