EST 1206400 is a singleton


Sequence

>1206400 (1 EST) Length=308 CGCGGAGTGTTATATGGAGGGTGGAACGCCTTCTTTGGACACGCTTGCCATGTCTCTTTCCGCCTATGTCAANCTTGTTA AATCCCTCCATTTCCCAATCGCACAATTAAAACAGAGAAATCTTCTGGGCCGCTGGCTGATCCTGAGTTGCTCAATAATA GAAACCAAACCAGATACGAATAACAAGGGATGCATGGAATAACAGTGGATTCACCACATCCTCAAAGTTTAACACCGGGT GACTGTATGGTTATATATTACCATCCGTTAAGCCTGAATCGTGGNCCGTTCATTCTATTTCGGATAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1206400: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064002327479AA556027TENF0029T.cruzi epimastigote normalized cDNA Library


Date: 3:46:35 on Sat 18 Nov 117.