EST 1206406 is a singleton


Sequence

>1206406 (1 EST) Length=425 CGCACACGCTCGACGCCCCACTGCCCGGCAACCGCGCTCCCCCAAGACATTTTTTTCCTACTCTTACCAACACTTCTAGC GACACGGTGGCATCTGGGTGCCAAAGACGTGGTCGGGCAGCTACAAGAATTTCCTGCTGTAAAGAAGTGCCATTGGGAGA GCTTTTCGGTACACAGATCCTCCCTGATGACCAGCCTCCTGCGGGCCATTGGCGTGCTTGTGGAGGCTGGCTGATCCTGC GGTAGAAGGATCGCCTGCTGGCACTTCTTTTTGGATGTCGGTTGGCGTCTGGNTTGTGTGCGCAGACTTGCTGTGCGGTG CGGTGCTTCTCCGTGTGGGAAAGACCATATCACAGAAATCGCATTTAAGCTCGGGAAGCGGGTGGAGAATGTTCCGGATG AAATAACCGACAGTAATTGACGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1206406: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064062327485AA556033TENF0044T.cruzi epimastigote normalized cDNA Library


Date: 20:52:57 on Wed 22 Nov 117.