EST 1206417 is a singleton


Sequence

>1206417 (1 EST) Length=389 GGCACGAGGGTTTTTTTATGAATTGCCGCTGCTTGGTCTGCAGTGCAATATCATGAGCTTGAGCAGCCTTTTTCTCCTTA TTTCTACCATGCACCTCTGCTGTACAGTTTTGTTTGTGCGTCCCTTCACATGTTCTGCTCCTGTTTTTACTTCTTTGCCT CGTGTGTCTGCAGGCACACAACCACATGCACGCACAANATGCAGTGGATTTGGATGCTTCTTTTGTAGCGTGTGCTTGCG GCTGCGTGTGGCTGCTGCTTCATCACTTCGTGGACATGAAGAGAAGGAAGAGACAGTGGGAGTGCGTCGTGGCTCTCATC CCCTGTGGGAATGCTGCACGGCGTGTGGCGGTATTGCCCTGAAATGCCGAACCATCACGCACGAAGAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1206417: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064172327496AA556044TENF0168T.cruzi epimastigote normalized cDNA Library


Date: 6:0:20 on Sun 19 Nov 117.