EST 1206427 is a singleton


Sequence

>1206427 (1 EST) Length=431 GGCACAGGTGGCCAGCGTTGCTCCAACGTGGCGNGCATCCACCGCCTCCTCCAGGCGTACGGTGCGCTGAAGTACACGAC TGTNATGGCCGCCACCGCTGCCGAGCCCGCTGGCCTCCAGTACCTCGCACCATACGCCGGCGTGACAATGGGTGAGTACT TCATGAACCGTGGACGTCACTGCCTGTGTGTGTACGACGATCTTTCGAAGCAGGCCGTTGCATATCGTCAGATTTCGCTG CTCCTGCGCCGCCCGCCTGGGGTTGAGGCGTACCCTGGCGACGTCTTTTACCTGCACTCGCGTCTATTGGAACGTGCTGC CATGCTTTCGCCCGGAAAAGGGGTTGGCTCCGTGACTGCTCTTCCCATCGTTGAGAAGCTCTCAATGAAGTGACGGCGTA ACATCGTGACGAACGTGAATCTCCATCAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1206427: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064272327506AA556054TENF0235T.cruzi epimastigote normalized cDNA Library


Date: 20:13:35 on Sat 18 Nov 117.