EST 1206430 is a singleton


Sequence

>1206430 (1 EST) Length=455 GGCACGAGGTACAGTTTCTGTACTATATTGAAAACATTAATTGAAATCAAAAAAAAAAAAAAAAAAAAAAGAAATCTTCG CCCCGCTCTCAGAAAAAAAGAAAAAAACACACACACACAAGAAAAGCTTTGTCATGTTTCGTCGTATGGCCGTGACTTCG TTGCAGAAGGGTCTTTCACGCCGGGCTTTCTGCAACACCCTGCGACTTCTTAACCTGGACTACCAAGCATATAAGACTGC CACGGTGCGCGAGGCAGCACCTGAGTGGGCAGGAAAAGCTGTCGTGAATGGAAAAATCCAGGACATCAGCTTGAATGACT ACAAGGGCAAGTATGTTGTTCTTCTTTTTTATCCTATGGATTTTACCTTTTGTGTGCCCACAGAAATCACAGCCTTTTCA GATGCTCAGGCAGAATTTGATAAGATTAACACCAGGTCGTGGCTGTTTCATGCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1206430: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064302327509AA556057TENF0252T.cruzi epimastigote normalized cDNA Library


Date: 17:0:35 on Wed 22 Nov 117.