EST 1206443 is a singleton


Sequence

>1206443 (1 EST) Length=409 TAGGGGTGGTGTGATGCCGAGCCTGAACAAGGCGCTGGCGAAGAAGCACAAGAGCAGCAAGAAGGCGAGGGCGACGCCAG CGCTTAGAGCGGCCTTCAGGCAGGCGCAGGGAGGGGGCGCAACATGTTAGATGCACCTGGGTGGCCGTCGTCGCTGAGCC ACGGTGACCCACACGTAGCCCTATAGAATAGGATTGGTTTGTTGTTGTTTTCTTTTCGTTTTCTACTGCCTCTCCTCCCG CTGTTGTGTAGGTCTCTGCGGCGCCTCGGCATCGGTGCTTGGCCGCATTGTGGCGTGCCGTGCGCTTTTTCCTCTGCTTT GGCCGCAGTCTCCTGCCCCCGCCCTTCTCTCCTCCCTTTGTTTCCCANGATCAAAGCCAAGCCAAGGAACCCAACCACAC TTGATTTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1206443: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064432327522AA556070TENF0297T.cruzi epimastigote normalized cDNA Library


Date: 8:15:27 on Thu 23 Nov 117.