EST 1206445 is a singleton


Sequence

>1206445 (1 EST) Length=347 GGCACGAGGCTTTGCAGTGTCCAGAGTGTGAAATGGGCAATAAAACAAGCGGAGTGTTATATGGAGGGTGGAACGCCTTC TTTGGACACGCTTGCCATGTCTCTTTCCGCCTATGTGCGCCTTGGTCCGAATGCTGCGGCAGCTCGAACCGATCCCTTAT GGGAGCGATACACCAGGGTACACGACAGCAATAAACTGTGTCGCTGTATTCTACGCNCTCTTTGTTGGGCAAATGACCCT TGCTATGTTGAGAACACCGCAGAGAACTGCATCTACAATGAGGGCNTTCGTGCACAATACGGTGGGGTGATCTTTGTGGG GGTTTGTTTCTAACCCTTCAATGCCGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1206445: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064452327524AA556072TENF0030T.cruzi epimastigote normalized cDNA Library


Date: 22:26:46 on Tue 21 Nov 117.