EST 1206450 is a singleton


Sequence

>1206450 (1 EST) Length=439 GGCACAGGTCAAACGTTGCTAGTGCGGTACATTTCTGAAAATAAAGAACAAATCTTTCCGCAGCTCAGCCTCAGTTCAGG ATATGAAGAAAAACTTACTCTACGACCAATTGCCGTGCGACTTGCTGAGTTGCTTAATCAACACGTTTACTTTGCTCACG ATTGTATGGATGCCAAGATGGAAATAAGTCTTCTCAGGAGAGGTGAGGTTATGCTGCTCGAGAACGTGCGCTTCTACGTG GAGGAGGGAAGCAAGAAGGAGGAGGAGCGTGACGCAATGGCACGCGTGCTGGCGTCGTACGGCGACGTGTACATCAGTGA CGCCTTTGGACAGCCCACCGCGAGAGTGCGACGATGACGGGCATTCCAAAGGTGCTTTGCCACGGTGCCGCCGGNTAACT TGATTGGAGAAGGGAATCTCGTACTTCGCGAAGGTGCTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1206450: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064502327529AA556077TENF0319T.cruzi epimastigote normalized cDNA Library


Date: 2:47:31 on Tue 21 Nov 117.