EST 1206458 is a singleton


Sequence

>1206458 (1 EST) Length=381 ATTGCCTTAAAACGAAGCGAGATTTATTGCGCATACACATATACATAAGTAGAGGGTGAAGGCATATTTGTTGCTGCCCA TGTTGGAACTGCCGCCAGTAGCGAGCCTGAAGGGCAAAAGCATCACAAGTGCCGAACAGTTCAGTCGTGCGGATATCTAC GCGCTGATTCATCTTGCAAGTGCCATTCAGCGTAAGATTGATGCGGGTGAGGTGCTGAATCTCCTGCAGGGCCGCATCAT GACGCCACTTTTTTTTGAGGATTCCTCTCGCACCTTCAGTTCCTTTTGTGCCGCGATGATTCGAATTGGTTGGAGCGTGG TTAACTTTAAGGTCGAGGCGTCATCCATCAACAAGGGCGANGACCCTCGCCGACACCATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1206458: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064582327537AA556085TENF0340T.cruzi epimastigote normalized cDNA Library


Date: 20:29:18 on Tue 21 Nov 117.