EST 1206461 is a singleton


Sequence

>1206461 (1 EST) Length=305 GAACTAAGGAGCAGGAACGACGAAACGGAGCAAATAGGTGAAATTCGACCAAGCGATACTTTTGTAAAAAACAGTCTTAT CATCAAACAAAATTTTGGTACTGTAAATTGGCTCTTTTTTGTGCGTGCGCTATTTCTTGAGAATGCAGCCTACAAACACG CGAAGGGGAGTCATGTGCACGCGGTCATGCAGGAGTGGTTGAAGGATGCCTTCTACCCGCAGACAATGGCATACAAACGG GCGGTGCTGAAAAAGGGCGTGGCTGCTTTTGACAGTGCATGGAAGCATTTATCATGAGGTTTGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1206461: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064612327540AA556088TENF0346T.cruzi epimastigote normalized cDNA Library


Date: 19:24:15 on Wed 22 Nov 117.