EST 1206469 is a singleton


Sequence

>1206469 (1 EST) Length=361 CACAAGCAGCAACAAGAAGATCTTGATGCCCATCTCAGAGAGCTCGCGATGATGAAAAAGGAGCTCGAGGATGAGCGTCG TCGCTTGGCTACAGAGAGGGAATTGGCTCGTCAAGAATCAACGGATCAGCAACACGCGCGTCTTGAACGTCAACGGCAGC GCGAGAAGGAGTTGGCATTAGAGCTTCAACGAGCGGAAGAAAACCTAGAAGTGGCTCTCGCAACCAAGCTGACTATGAGG CGTATGAAAAGGAACGCGAGGAGCGGAGGTTACGGGAGGAGGATGCCAGAAGGCTTGAGGAAGATCGCCGACGTCAGACA AATCTTCACGGAGATGAGACGCCGGCGTCAGTTTACCGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1206469: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064692327548AA556096TENF0381T.cruzi epimastigote normalized cDNA Library


Date: 21:56:51 on Sat 18 Nov 117.