EST 1206475 is a singleton


Sequence

>1206475 (1 EST) Length=391 CTTCTCACACAGTTCCCCGTGTCGGAAGAAACACTTAATAACTGTCATTATCTCGATGGCATGGATGCTCTCTCCGCACA TTCCGCACTTGGCTACTTCTTCTTCAACCTCATGTGTACTCCCATCGTACCAGAGGAAGAGACAGGCCGTTCCCGGCAGA CGAAAAGTGTCATTCAACGTTCTCTTGAGGCGGCCATGGAGGACAAACCACGCTCTTCCGTGCCCGCGGCGGTTCCTGTG GCTGTCATCGTCTTTCCTCGGTGGATTATAACGGTTCATGAAAAACCTTTTCATGAACTCGGTGATTTGCTCAAGTTTTT GCACATTAACTGTAGTGATCACGGCTCCAGTGCGACACCGCGGCGTCGCAGGCAAGTTATGACAGCCCCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1206475: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064752327554AA556102TENF0398T.cruzi epimastigote normalized cDNA Library


Date: 9:33:28 on Thu 23 Nov 117.