EST 1206477 is a singleton


Sequence

>1206477 (1 EST) Length=355 GTGTGTGTCTGTTACCACCGCGGCTCCATGCATAGAAAAAGAAGACAAGAAAAAAACAAAACATGACGCCTCCCACGTCA CACTTCGTTTTCGTCCGTCTTCTTCCTCCACCTGTTTGTGTTTGTTTCTGTTTGTTTGTTTATGTGCGTGTGTGTGTCAC TGCTGCTGTTGGGTGGTGCCTCTCAGGCCTGCAACATTATGTGTGAGTGTGTGAGCGTCAACGAGACTGCGTGCATGATG GCACGCCCATCGACACACACATTCGTTCACACATCTATTTATTCTCAACGCTTAGAGCATAAATTTGGGGAAGATAAAAT AAAATAGAGAAACAAAAATCGAACGTGAAGAGACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1206477: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064772327556AA556104TENF0403T.cruzi epimastigote normalized cDNA Library


Date: 23:28:23 on Sun 19 Nov 117.