EST 1206485 is a singleton


Sequence

>1206485 (1 EST) Length=392 AATAATAATAAATGGGCCAGTTACTCTGCTACACCTGCGTGGAGCAATCGGATGTGGCGTTATTGGAGACCTGCGGCAAG TACGTTGGAACGGCGGGGCCCGGTTGCCACTGCATACTCCCGTGGACTTCTAAAGCCGGGACGCTTTCCATGCGACTGTA CGAGCATAACATCCACATTCGGTCCAAGACGAAAGACAACGTCTTTGTCAATATCCGGTTGACGGTGCATGTGCAGGTGA TTCCTGGCCGGGAGAACTCGGCCTTTTACTCCGTTGAGGCCCCGCTAAAGGTCATTCAGAGCTATGTGGAGAACTGCGTG GAGACGAAAATCCCGCTCTATAACCTCGATGCGCTCTTTATCGAGCGTGGCANCATTTCCAGCAACTGAAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1206485: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064852327564AA556112TENF0438T.cruzi epimastigote normalized cDNA Library


Date: 14:11:56 on Mon 20 Nov 117.