EST 1206486 is a singleton


Sequence

>1206486 (1 EST) Length=419 GCCGCAACTTCCGTCAATGTCGTTTCTGTACCGCTAACTCCCATGGGTTGGGAGGAACTCTCCTCATCACTCGCTTTGGT ATCCCGTCACTGTCACGATCTCCAGCCCGTCGTCTCGTTGGGAGGAGCCCTTTCGACTTCCAGTTCATGACGCACTGCAT CAGATCCTTGTACCGTCGCCGCCGACGAAGCTCCAGAAAGAGTTGACGCTGCATCGCCGCGTTGTATTCCGCCCTCTCCT CCTCCTCCTCCTCGCCGTCGTCGTTATTCGAATCGGTGAAGTGAAGTGAAGCCCGTCTGCGTTGAGACTGCGGCCGCAAG CTTATTCCCTTTAGTGANGGTAATTTTAGCTTGGCACTGGCCGTCGTTTACAACGTCGTGACTTGGGAAAACCTGGCGTA ACCAAACTNAATCGCCTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1206486: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
12064862327565AA556113TENF0439T.cruzi epimastigote normalized cDNA Library


Date: 10:39:42 on Sat 18 Nov 117.